sgrna sequences Search Results


90
GenScript corporation the sgrna scaffold sequence
Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the <t>sgRNA</t> <t>scaffold.</t> (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.
The Sgrna Scaffold Sequence, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/the sgrna scaffold sequence/product/GenScript corporation
Average 90 stars, based on 1 article reviews
the sgrna scaffold sequence - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Microsynth ag sgrna sequences
Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the <t>sgRNA</t> <t>scaffold.</t> (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.
Sgrna Sequences, supplied by Microsynth ag, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sgrna sequences/product/Microsynth ag
Average 90 stars, based on 1 article reviews
sgrna sequences - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Cellecta Inc sgrna sequence library
Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the <t>sgRNA</t> <t>scaffold.</t> (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.
Sgrna Sequence Library, supplied by Cellecta Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sgrna sequence library/product/Cellecta Inc
Average 90 stars, based on 1 article reviews
sgrna sequence library - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Genechem crispr sgrna targeting sequence irp1 #2
Reduced <t>IRP1</t> expression mediates resistance to ferroptosis in TMZ-resistant glioblastoma cells (A) Images from transmission electron microscopy showing morphology of mitochondria in U87, U87TR, U251, U251TR cells after TMZ treatment for 24 h. Scale bar, 200 nm (down). (B) Representative confocal images of U87, U87TR, U251 and U251TR cells stained with the PGSK (green) probe to assess intracellular iron levels. Scale bar, 100 μm. (C) Representative confocal images of the cells stained with the JC-1 probe (Aggregates, red; Monomers, green) to assess mitochondrial membrane potential. Scale bar, 100 μm. (D) Representative confocal images of U87, U87TR, U251 and U251TR cells stained with the TMRE (red) dye to assess mitochondrial membrane potential. Scale bar, 100 μm. (E) Representative confocal images of the cells stained with the MitoSOX Red reagent (red) to assess mitochondrial ROS levels. Scale bar, 100 μm. (F) Representative confocal images of the cells treated with erastin (10 μM) for 24 h stained with the DCF-DA (green) dye to assess cellular ROS. Scale bar, 100 μm. (G) Lipid peroxidation level in parental and TR cells was influenced by erastin (10 μM) 24 h assessed by DCF-DA using flow cytometry immunolabelling. (H) Western blot analysis of IRP1 and IRP2 protein levels in parental and TR cells. (I) qRT-PCR to detect IRP1 mRNA levels in parental and TR cells. (J) Kaplan–Meier survival analysis of patient overall survival data based on high versus low expression of IRP1 from the TCGA dataset.
Crispr Sgrna Targeting Sequence Irp1 #2, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/crispr sgrna targeting sequence irp1 #2/product/Genechem
Average 90 stars, based on 1 article reviews
crispr sgrna targeting sequence irp1 #2 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Sangon Biotech single-guide rna (sgrna) sequence
Reduced <t>IRP1</t> expression mediates resistance to ferroptosis in TMZ-resistant glioblastoma cells (A) Images from transmission electron microscopy showing morphology of mitochondria in U87, U87TR, U251, U251TR cells after TMZ treatment for 24 h. Scale bar, 200 nm (down). (B) Representative confocal images of U87, U87TR, U251 and U251TR cells stained with the PGSK (green) probe to assess intracellular iron levels. Scale bar, 100 μm. (C) Representative confocal images of the cells stained with the JC-1 probe (Aggregates, red; Monomers, green) to assess mitochondrial membrane potential. Scale bar, 100 μm. (D) Representative confocal images of U87, U87TR, U251 and U251TR cells stained with the TMRE (red) dye to assess mitochondrial membrane potential. Scale bar, 100 μm. (E) Representative confocal images of the cells stained with the MitoSOX Red reagent (red) to assess mitochondrial ROS levels. Scale bar, 100 μm. (F) Representative confocal images of the cells treated with erastin (10 μM) for 24 h stained with the DCF-DA (green) dye to assess cellular ROS. Scale bar, 100 μm. (G) Lipid peroxidation level in parental and TR cells was influenced by erastin (10 μM) 24 h assessed by DCF-DA using flow cytometry immunolabelling. (H) Western blot analysis of IRP1 and IRP2 protein levels in parental and TR cells. (I) qRT-PCR to detect IRP1 mRNA levels in parental and TR cells. (J) Kaplan–Meier survival analysis of patient overall survival data based on high versus low expression of IRP1 from the TCGA dataset.
Single Guide Rna (Sgrna) Sequence, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/single-guide rna (sgrna) sequence/product/Sangon Biotech
Average 90 stars, based on 1 article reviews
single-guide rna (sgrna) sequence - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
CustomArray Inc 20 nt target specific sgrna sequences
a , Schematic of <t>genome-scale</t> <t>CRISPRa</t> screening approach (see text for details). b , Overview of CRISPRa screen results. Negative τ values indicate depletion and positive values enrichment of cells following imatinib selection. Significant candidate genes (FDR<0.05, p<0.001) are in colour (blue = depleted, red = enriched). Validated candidate genes are labelled in black. Mann-Whitney U test was used to calculate p-values as described previously . To correct for multiple hypothesis testing, we first performed random sampling with replacement among the set of τ values for non-targeting control sgRNAs and calculated p-values for each sampling. Then, we calculated the false discover rate (FDR) based on the distribution of p-values for all genes in the library and for non-targeting controls generated above. c, Candidate gene validation. Enrichment of candidate <t>sgRNA</t> expressing cells was measured over time. Values represent the mean of three different sgRNAs targeting each gene with s.e.m. Grey shading = two standard deviations of sgNTCs at day 15. All values from separate sgRNAs on days 7, 11 and 15 normalised to baseline or untreated cells are shown in .
20 Nt Target Specific Sgrna Sequences, supplied by CustomArray Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/20 nt target specific sgrna sequences/product/CustomArray Inc
Average 90 stars, based on 1 article reviews
20 nt target specific sgrna sequences - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Shanghai GenePharma sgrna sequences fbxw7β
a Transfection efficiency of HN6 and CAL27 NOTCH1 C1133Y and WT cells determined by real-time qPCR. b Growth curves of NOTCH1 WT -transfected cells (blue lines), NOTCH1 C1133Y -transfected cells (red lines) and control cells (black lines). The NOTCH1 C1133Y -transfected cells had higher proliferation rates compared with the NOTCH1 WT -transfected cells. c Colony formation assays were performed for 2 week in six-well cell culture cluster in HN6 and CAL27 stable transfected cells. d NOTCH1 C1133Y - transfected cells presented a significantly lower percentage of G1 phase and higher ratio of S phase than NOTCH1 WT cells. e , f Wound healing and Transwell assays were employed to analyze the cell migration and invasion ability. NOTCH1 C1133Y -transfected cells exhibited higher metastatic ability in HN6 and CAL27 cell lines compared with NOTCH1 WT -transfected cells. g mRNA expression levels of three isoforms of FBXW7 (relative to GAPDH) after transfection of NOTCH1 C1133Y or NOTCH1 WT in HN6 and CAL27 cells. <t>FBXW7β</t> mRNA was greatly reduced in NOTCH1 C1133Y transfected cells compared to FBXW7α or FBXW7γ mRNA levels. h Left panel, the band of FBXW7 were detected by western blot after transfection of three individual isoform plasmids. Right panel, the alteration of FBXW7β protein levels in NOTCH1 C1133Y overexpressed cells. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.
Sgrna Sequences Fbxw7β, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sgrna sequences fbxw7β/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
sgrna sequences fbxw7β - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Promega pcr products containing the sgrna sequences
a Transfection efficiency of HN6 and CAL27 NOTCH1 C1133Y and WT cells determined by real-time qPCR. b Growth curves of NOTCH1 WT -transfected cells (blue lines), NOTCH1 C1133Y -transfected cells (red lines) and control cells (black lines). The NOTCH1 C1133Y -transfected cells had higher proliferation rates compared with the NOTCH1 WT -transfected cells. c Colony formation assays were performed for 2 week in six-well cell culture cluster in HN6 and CAL27 stable transfected cells. d NOTCH1 C1133Y - transfected cells presented a significantly lower percentage of G1 phase and higher ratio of S phase than NOTCH1 WT cells. e , f Wound healing and Transwell assays were employed to analyze the cell migration and invasion ability. NOTCH1 C1133Y -transfected cells exhibited higher metastatic ability in HN6 and CAL27 cell lines compared with NOTCH1 WT -transfected cells. g mRNA expression levels of three isoforms of FBXW7 (relative to GAPDH) after transfection of NOTCH1 C1133Y or NOTCH1 WT in HN6 and CAL27 cells. <t>FBXW7β</t> mRNA was greatly reduced in NOTCH1 C1133Y transfected cells compared to FBXW7α or FBXW7γ mRNA levels. h Left panel, the band of FBXW7 were detected by western blot after transfection of three individual isoform plasmids. Right panel, the alteration of FBXW7β protein levels in NOTCH1 C1133Y overexpressed cells. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.
Pcr Products Containing The Sgrna Sequences, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pcr products containing the sgrna sequences/product/Promega
Average 90 stars, based on 1 article reviews
pcr products containing the sgrna sequences - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Genechem sgrnas matching col4a1 gene promoter sequences
a Transfection efficiency of HN6 and CAL27 NOTCH1 C1133Y and WT cells determined by real-time qPCR. b Growth curves of NOTCH1 WT -transfected cells (blue lines), NOTCH1 C1133Y -transfected cells (red lines) and control cells (black lines). The NOTCH1 C1133Y -transfected cells had higher proliferation rates compared with the NOTCH1 WT -transfected cells. c Colony formation assays were performed for 2 week in six-well cell culture cluster in HN6 and CAL27 stable transfected cells. d NOTCH1 C1133Y - transfected cells presented a significantly lower percentage of G1 phase and higher ratio of S phase than NOTCH1 WT cells. e , f Wound healing and Transwell assays were employed to analyze the cell migration and invasion ability. NOTCH1 C1133Y -transfected cells exhibited higher metastatic ability in HN6 and CAL27 cell lines compared with NOTCH1 WT -transfected cells. g mRNA expression levels of three isoforms of FBXW7 (relative to GAPDH) after transfection of NOTCH1 C1133Y or NOTCH1 WT in HN6 and CAL27 cells. <t>FBXW7β</t> mRNA was greatly reduced in NOTCH1 C1133Y transfected cells compared to FBXW7α or FBXW7γ mRNA levels. h Left panel, the band of FBXW7 were detected by western blot after transfection of three individual isoform plasmids. Right panel, the alteration of FBXW7β protein levels in NOTCH1 C1133Y overexpressed cells. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.
Sgrnas Matching Col4a1 Gene Promoter Sequences, supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sgrnas matching col4a1 gene promoter sequences/product/Genechem
Average 90 stars, based on 1 article reviews
sgrnas matching col4a1 gene promoter sequences - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Twist Bioscience sgrna sequences
a Transfection efficiency of HN6 and CAL27 NOTCH1 C1133Y and WT cells determined by real-time qPCR. b Growth curves of NOTCH1 WT -transfected cells (blue lines), NOTCH1 C1133Y -transfected cells (red lines) and control cells (black lines). The NOTCH1 C1133Y -transfected cells had higher proliferation rates compared with the NOTCH1 WT -transfected cells. c Colony formation assays were performed for 2 week in six-well cell culture cluster in HN6 and CAL27 stable transfected cells. d NOTCH1 C1133Y - transfected cells presented a significantly lower percentage of G1 phase and higher ratio of S phase than NOTCH1 WT cells. e , f Wound healing and Transwell assays were employed to analyze the cell migration and invasion ability. NOTCH1 C1133Y -transfected cells exhibited higher metastatic ability in HN6 and CAL27 cell lines compared with NOTCH1 WT -transfected cells. g mRNA expression levels of three isoforms of FBXW7 (relative to GAPDH) after transfection of NOTCH1 C1133Y or NOTCH1 WT in HN6 and CAL27 cells. <t>FBXW7β</t> mRNA was greatly reduced in NOTCH1 C1133Y transfected cells compared to FBXW7α or FBXW7γ mRNA levels. h Left panel, the band of FBXW7 were detected by western blot after transfection of three individual isoform plasmids. Right panel, the alteration of FBXW7β protein levels in NOTCH1 C1133Y overexpressed cells. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.
Sgrna Sequences, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sgrna sequences/product/Twist Bioscience
Average 90 stars, based on 1 article reviews
sgrna sequences - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Oligos Etc sgrna sequence (5’ to 3’) 5 caccg ttaccgttttcgccttggca
a Transfection efficiency of HN6 and CAL27 NOTCH1 C1133Y and WT cells determined by real-time qPCR. b Growth curves of NOTCH1 WT -transfected cells (blue lines), NOTCH1 C1133Y -transfected cells (red lines) and control cells (black lines). The NOTCH1 C1133Y -transfected cells had higher proliferation rates compared with the NOTCH1 WT -transfected cells. c Colony formation assays were performed for 2 week in six-well cell culture cluster in HN6 and CAL27 stable transfected cells. d NOTCH1 C1133Y - transfected cells presented a significantly lower percentage of G1 phase and higher ratio of S phase than NOTCH1 WT cells. e , f Wound healing and Transwell assays were employed to analyze the cell migration and invasion ability. NOTCH1 C1133Y -transfected cells exhibited higher metastatic ability in HN6 and CAL27 cell lines compared with NOTCH1 WT -transfected cells. g mRNA expression levels of three isoforms of FBXW7 (relative to GAPDH) after transfection of NOTCH1 C1133Y or NOTCH1 WT in HN6 and CAL27 cells. <t>FBXW7β</t> mRNA was greatly reduced in NOTCH1 C1133Y transfected cells compared to FBXW7α or FBXW7γ mRNA levels. h Left panel, the band of FBXW7 were detected by western blot after transfection of three individual isoform plasmids. Right panel, the alteration of FBXW7β protein levels in NOTCH1 C1133Y overexpressed cells. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.
Sgrna Sequence (5’ To 3’) 5 Caccg Ttaccgttttcgccttggca, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sgrna sequence (5’ to 3’) 5 caccg ttaccgttttcgccttggca/product/Oligos Etc
Average 90 stars, based on 1 article reviews
sgrna sequence (5’ to 3’) 5 caccg ttaccgttttcgccttggca - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Synbio Technologies LLC sgrna sequences
a Transfection efficiency of HN6 and CAL27 NOTCH1 C1133Y and WT cells determined by real-time qPCR. b Growth curves of NOTCH1 WT -transfected cells (blue lines), NOTCH1 C1133Y -transfected cells (red lines) and control cells (black lines). The NOTCH1 C1133Y -transfected cells had higher proliferation rates compared with the NOTCH1 WT -transfected cells. c Colony formation assays were performed for 2 week in six-well cell culture cluster in HN6 and CAL27 stable transfected cells. d NOTCH1 C1133Y - transfected cells presented a significantly lower percentage of G1 phase and higher ratio of S phase than NOTCH1 WT cells. e , f Wound healing and Transwell assays were employed to analyze the cell migration and invasion ability. NOTCH1 C1133Y -transfected cells exhibited higher metastatic ability in HN6 and CAL27 cell lines compared with NOTCH1 WT -transfected cells. g mRNA expression levels of three isoforms of FBXW7 (relative to GAPDH) after transfection of NOTCH1 C1133Y or NOTCH1 WT in HN6 and CAL27 cells. <t>FBXW7β</t> mRNA was greatly reduced in NOTCH1 C1133Y transfected cells compared to FBXW7α or FBXW7γ mRNA levels. h Left panel, the band of FBXW7 were detected by western blot after transfection of three individual isoform plasmids. Right panel, the alteration of FBXW7β protein levels in NOTCH1 C1133Y overexpressed cells. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.
Sgrna Sequences, supplied by Synbio Technologies LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sgrna sequences/product/Synbio Technologies LLC
Average 90 stars, based on 1 article reviews
sgrna sequences - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the sgRNA scaffold. (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.

Journal: STAR Protocols

Article Title: Efficient CRISPR-Cas9-mediated genome editing for characterization of essential genes in Trypanosoma cruzi

doi: 10.1016/j.xpro.2022.101324

Figure Lengend Snippet: Representative steps to knock out the target gene by CRISPR-Cas9 (A) Amplify the sgRNA scaffold. (B) Obtain sgTemplate DNA. (C) Generate the sgRNA by in vitro transcription. (D) Knock out target gene using the obtained sgRNA.

Article Snippet: Note: In this work, the sgRNA scaffold sequence was acquired cloned into pUC19 from GenScript, but the sgRNA scaffold can be cloned in any other vector. a. Scaffold sequence: GAATTC CATGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT AAGCTT .

Techniques: Knock-Out, CRISPR, In Vitro

Journal: STAR Protocols

Article Title: Efficient CRISPR-Cas9-mediated genome editing for characterization of essential genes in Trypanosoma cruzi

doi: 10.1016/j.xpro.2022.101324

Figure Lengend Snippet:

Article Snippet: Note: In this work, the sgRNA scaffold sequence was acquired cloned into pUC19 from GenScript, but the sgRNA scaffold can be cloned in any other vector. a. Scaffold sequence: GAATTC CATGGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT AAGCTT .

Techniques: Virus, Recombinant, Transfection, Plasmid Preparation, Staining, Expressing, Software, CRISPR, Cytometry

Reduced IRP1 expression mediates resistance to ferroptosis in TMZ-resistant glioblastoma cells (A) Images from transmission electron microscopy showing morphology of mitochondria in U87, U87TR, U251, U251TR cells after TMZ treatment for 24 h. Scale bar, 200 nm (down). (B) Representative confocal images of U87, U87TR, U251 and U251TR cells stained with the PGSK (green) probe to assess intracellular iron levels. Scale bar, 100 μm. (C) Representative confocal images of the cells stained with the JC-1 probe (Aggregates, red; Monomers, green) to assess mitochondrial membrane potential. Scale bar, 100 μm. (D) Representative confocal images of U87, U87TR, U251 and U251TR cells stained with the TMRE (red) dye to assess mitochondrial membrane potential. Scale bar, 100 μm. (E) Representative confocal images of the cells stained with the MitoSOX Red reagent (red) to assess mitochondrial ROS levels. Scale bar, 100 μm. (F) Representative confocal images of the cells treated with erastin (10 μM) for 24 h stained with the DCF-DA (green) dye to assess cellular ROS. Scale bar, 100 μm. (G) Lipid peroxidation level in parental and TR cells was influenced by erastin (10 μM) 24 h assessed by DCF-DA using flow cytometry immunolabelling. (H) Western blot analysis of IRP1 and IRP2 protein levels in parental and TR cells. (I) qRT-PCR to detect IRP1 mRNA levels in parental and TR cells. (J) Kaplan–Meier survival analysis of patient overall survival data based on high versus low expression of IRP1 from the TCGA dataset.

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet: Reduced IRP1 expression mediates resistance to ferroptosis in TMZ-resistant glioblastoma cells (A) Images from transmission electron microscopy showing morphology of mitochondria in U87, U87TR, U251, U251TR cells after TMZ treatment for 24 h. Scale bar, 200 nm (down). (B) Representative confocal images of U87, U87TR, U251 and U251TR cells stained with the PGSK (green) probe to assess intracellular iron levels. Scale bar, 100 μm. (C) Representative confocal images of the cells stained with the JC-1 probe (Aggregates, red; Monomers, green) to assess mitochondrial membrane potential. Scale bar, 100 μm. (D) Representative confocal images of U87, U87TR, U251 and U251TR cells stained with the TMRE (red) dye to assess mitochondrial membrane potential. Scale bar, 100 μm. (E) Representative confocal images of the cells stained with the MitoSOX Red reagent (red) to assess mitochondrial ROS levels. Scale bar, 100 μm. (F) Representative confocal images of the cells treated with erastin (10 μM) for 24 h stained with the DCF-DA (green) dye to assess cellular ROS. Scale bar, 100 μm. (G) Lipid peroxidation level in parental and TR cells was influenced by erastin (10 μM) 24 h assessed by DCF-DA using flow cytometry immunolabelling. (H) Western blot analysis of IRP1 and IRP2 protein levels in parental and TR cells. (I) qRT-PCR to detect IRP1 mRNA levels in parental and TR cells. (J) Kaplan–Meier survival analysis of patient overall survival data based on high versus low expression of IRP1 from the TCGA dataset.

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques: Expressing, Transmission Assay, Electron Microscopy, Staining, Membrane, Flow Cytometry, Western Blot, Quantitative RT-PCR

Overexpressed IRP1 increases TMZ chemotherapy sensitivity by enhancing ferroptosis, lipid peroxidation and free iron accumulation (A) The cell survival rate was measured after TMZ treatment in U87TR-NC, U87TR-lvIRP1, U251TR-NC and U251TR-lvIRP1 groups. Data are represented as the mean ± SD (n = 6). (B) Representative confocal images of the TR and TR-lvIRP1 groups stained with the PGSK (green) probe to assess intracellular iron levels. Scale bar, 100 μm. (C) Representative confocal images of the TR and TR-lvIRP1 groups stained with the JC-1 probe (Aggregates, red; Monomers, green) to assess mitochondrial membrane potential. Scale bar, 100 μm. (D) Representative confocal images of the TR and TR-lvIRP1 groups stained with the TMRE (red) dye to assess mitochondrial membrane potential. Scale bar, 100 μm. (E) Representative confocal images of the TR and TR-lvIRP1 groups stained with the MitoSOX Red reagent (red) to assess mitochondrial ROS levels. Scale bar, 100 μm. (F) Representative confocal images of the cells treated with erastin (10 μM) for 24 h stained with the DCF-DA (green) dye to assess cellular ROS. Scale bar, 100 μm. (G) Lipid peroxidation level in TR and TR-lvIRP1 groups was influenced by erastin (10 μM) 24 h assessed by DCF-DA using flow cytometry immunolabelling.

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet: Overexpressed IRP1 increases TMZ chemotherapy sensitivity by enhancing ferroptosis, lipid peroxidation and free iron accumulation (A) The cell survival rate was measured after TMZ treatment in U87TR-NC, U87TR-lvIRP1, U251TR-NC and U251TR-lvIRP1 groups. Data are represented as the mean ± SD (n = 6). (B) Representative confocal images of the TR and TR-lvIRP1 groups stained with the PGSK (green) probe to assess intracellular iron levels. Scale bar, 100 μm. (C) Representative confocal images of the TR and TR-lvIRP1 groups stained with the JC-1 probe (Aggregates, red; Monomers, green) to assess mitochondrial membrane potential. Scale bar, 100 μm. (D) Representative confocal images of the TR and TR-lvIRP1 groups stained with the TMRE (red) dye to assess mitochondrial membrane potential. Scale bar, 100 μm. (E) Representative confocal images of the TR and TR-lvIRP1 groups stained with the MitoSOX Red reagent (red) to assess mitochondrial ROS levels. Scale bar, 100 μm. (F) Representative confocal images of the cells treated with erastin (10 μM) for 24 h stained with the DCF-DA (green) dye to assess cellular ROS. Scale bar, 100 μm. (G) Lipid peroxidation level in TR and TR-lvIRP1 groups was influenced by erastin (10 μM) 24 h assessed by DCF-DA using flow cytometry immunolabelling.

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques: Staining, Membrane, Flow Cytometry

Knockout of IRP1 reduced chemotherapy sensitivity by inhibiting ferroptosis, lipid peroxidation, and free iron accumulation (A) The cell survival rate was measured after TMZ treatment in U87NC, U87KO, U251NC and U251KO groups. Data are represented as the mean ± SD (n = 6). (B) Representative confocal images of the NC and KO groups stained with the PGSK (green) probe to assess intracellular iron levels. Scale bar, 100 μm. (C) Representative confocal images of the NC and KO cells stained with the JC-1 probe (Aggregates, red; Monomers, green) to assess mitochondrial membrane potential. Scale bar, 100 μm. (D) Representative confocal images of the NC and KO cells stained with the TMRE (red) dye to assess mitochondrial membrane potential. Scale bar, 100 μm. (E) Representative confocal images of the NC and KO groups stained with the MitoSOX Red reagent (red) to assess mitochondrial ROS levels. Scale bar, 100 μm. (F) Representative confocal images of the sgRNA-IRP1#1 transfected group and the sgRNA-IRP1#1 non-transfected group treated with erastin (10 μM) for 24 h stained with the DCF-DA (green) dye to assess cellular ROS. Scale bar, 100 μm. (G) Lipid peroxidation level in the sgRNA-IRP1#1 transfected group and the sgRNA-IRP1#1 non-transfected group assessed by DCF-DA using flow cytometry immunolabelling.

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet: Knockout of IRP1 reduced chemotherapy sensitivity by inhibiting ferroptosis, lipid peroxidation, and free iron accumulation (A) The cell survival rate was measured after TMZ treatment in U87NC, U87KO, U251NC and U251KO groups. Data are represented as the mean ± SD (n = 6). (B) Representative confocal images of the NC and KO groups stained with the PGSK (green) probe to assess intracellular iron levels. Scale bar, 100 μm. (C) Representative confocal images of the NC and KO cells stained with the JC-1 probe (Aggregates, red; Monomers, green) to assess mitochondrial membrane potential. Scale bar, 100 μm. (D) Representative confocal images of the NC and KO cells stained with the TMRE (red) dye to assess mitochondrial membrane potential. Scale bar, 100 μm. (E) Representative confocal images of the NC and KO groups stained with the MitoSOX Red reagent (red) to assess mitochondrial ROS levels. Scale bar, 100 μm. (F) Representative confocal images of the sgRNA-IRP1#1 transfected group and the sgRNA-IRP1#1 non-transfected group treated with erastin (10 μM) for 24 h stained with the DCF-DA (green) dye to assess cellular ROS. Scale bar, 100 μm. (G) Lipid peroxidation level in the sgRNA-IRP1#1 transfected group and the sgRNA-IRP1#1 non-transfected group assessed by DCF-DA using flow cytometry immunolabelling.

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques: Knock-Out, Staining, Membrane, Transfection, Flow Cytometry

Knockout of IRP1 activates the noncanonical NF-κB pathway through NFKB2 (A) Clustering heatmap of mRNA from the NC and KO cells on the basis of differential expression analysis. Control group: n = 3; IRP1 KO group: n = 3. (B) Volcano plot displays differential genes expression in U87KO cells. Up (red), down (blue). (C) KEGG pathway analysis of upregulated genes. Tops of enriched pathway are shown. (D) Western blot to detect major protein levels in the canonical NF-κB pathway in U87NC, U87KO, U251NC and U251KO cells. (E) Western blot to detect major protein levels in the noncanonical NF-κB pathway in U87NC, U87KO, U251NC and U251KO cells. (F) qRT-PCR to detect the NFKB1 mRNA levels in U87NC, U87KO, U251NC and U251KO cells. (G) qRT-PCR to detect the NFKB2 mRNA levels in U87NC, U87KO, U251NC and U251KO cells. (H) IF confocal images of IRP1 (green), NFKB2 (red), and nuclei (blue). Scale bar, 20 μm.

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet: Knockout of IRP1 activates the noncanonical NF-κB pathway through NFKB2 (A) Clustering heatmap of mRNA from the NC and KO cells on the basis of differential expression analysis. Control group: n = 3; IRP1 KO group: n = 3. (B) Volcano plot displays differential genes expression in U87KO cells. Up (red), down (blue). (C) KEGG pathway analysis of upregulated genes. Tops of enriched pathway are shown. (D) Western blot to detect major protein levels in the canonical NF-κB pathway in U87NC, U87KO, U251NC and U251KO cells. (E) Western blot to detect major protein levels in the noncanonical NF-κB pathway in U87NC, U87KO, U251NC and U251KO cells. (F) qRT-PCR to detect the NFKB1 mRNA levels in U87NC, U87KO, U251NC and U251KO cells. (G) qRT-PCR to detect the NFKB2 mRNA levels in U87NC, U87KO, U251NC and U251KO cells. (H) IF confocal images of IRP1 (green), NFKB2 (red), and nuclei (blue). Scale bar, 20 μm.

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques: Knock-Out, Quantitative Proteomics, Control, Expressing, Western Blot, Quantitative RT-PCR

Knockdown of NFKB2 enhanced ferroptosis sensitivity and reversed TMZ resistance (A) The cell survival rate was measured after TMZ treatment in U87KO-NC, U87KO-shNFKB2, U251KO-NC and U251KO-shNFKB2 groups. Data are represented as the mean ± SD (n = 6). (B) Representative confocal images of the IRP1-KO-NC and IRP1-KO-shNFKB2 groups stained with the PGSK (green) probe to assess intracellular iron levels. Scale bar, 100 μm. (C) Representative confocal images of the IRP1-KO-NC and IRP1-KO-shNFKB2 groups stained with the JC-1 probe (Aggregates, red; Monomers, green) to assess mitochondrial membrane potential. Scale bar, 100 μm. (D) Representative confocal images of the IRP1-KO-NC and IRP1-KO-shNFKB2 groups stained with the TMRE (red) dye to assess mitochondrial membrane potential. Scale bar, 100 μm. (E) Representative confocal images of the IRP1-KO-NC and IRP1-KO-shNFKB2 groups stained with the MitoSOX Red reagent (red) to assess mitochondrial ROS levels. Scale bar, 100 μm. (F) Representative confocal images of the shRNA-NFKB2 transfected group and the shRNA-NFKB2 non-transfected group treated with erastin (10 μM) for 24 h stained with the DCF-DA (green) dye to assess cellular ROS. Scale bar, 100 μm. (G) Lipid peroxidation level in the shRNA-NFKB2 transfected group and the shRNA-NFKB2 non-transfected group assessed by DCF-DA using flow cytometry immunolabelling.

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet: Knockdown of NFKB2 enhanced ferroptosis sensitivity and reversed TMZ resistance (A) The cell survival rate was measured after TMZ treatment in U87KO-NC, U87KO-shNFKB2, U251KO-NC and U251KO-shNFKB2 groups. Data are represented as the mean ± SD (n = 6). (B) Representative confocal images of the IRP1-KO-NC and IRP1-KO-shNFKB2 groups stained with the PGSK (green) probe to assess intracellular iron levels. Scale bar, 100 μm. (C) Representative confocal images of the IRP1-KO-NC and IRP1-KO-shNFKB2 groups stained with the JC-1 probe (Aggregates, red; Monomers, green) to assess mitochondrial membrane potential. Scale bar, 100 μm. (D) Representative confocal images of the IRP1-KO-NC and IRP1-KO-shNFKB2 groups stained with the TMRE (red) dye to assess mitochondrial membrane potential. Scale bar, 100 μm. (E) Representative confocal images of the IRP1-KO-NC and IRP1-KO-shNFKB2 groups stained with the MitoSOX Red reagent (red) to assess mitochondrial ROS levels. Scale bar, 100 μm. (F) Representative confocal images of the shRNA-NFKB2 transfected group and the shRNA-NFKB2 non-transfected group treated with erastin (10 μM) for 24 h stained with the DCF-DA (green) dye to assess cellular ROS. Scale bar, 100 μm. (G) Lipid peroxidation level in the shRNA-NFKB2 transfected group and the shRNA-NFKB2 non-transfected group assessed by DCF-DA using flow cytometry immunolabelling.

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques: Knockdown, Staining, Membrane, shRNA, Transfection, Flow Cytometry

High expression of NFKB2 activates LCN2/FPN1 to mediate ferroptosis resistance in GBM cells (A) Western Blot analysis detected the expression of LCN2 and FPN1 in IRP1-NC and IRP1-KO cells. (B and C) qRT-PCR detected the expression of LCN2 and FPN1 in IRP1-NC and IRP1-KO cells. (D) Western Blot analysis to detect NFKB2 protein levels in parental cells transfected with lv-NFKB2. (E and F) qRT-PCR detected the expression of LCN2 and FPN1 in NC and lvNFKB2 cells. (G) ChIP assay of the enrichment of NFKB2 in the LCN2 and FPN1 promoter region normalized to IgG in U87 cells. (H) Ferrous iron levels detected after overexpression of NFKB2 in parental cells. (I) MDA levels detected after overexpression of NFKB2 in parental cells. (J) DCF levels detected after overexpression of NFKB2 in parental cells. (K) Western Blot analysis detected the expression of LCN2 and FPN1 in IRP1-KO-NC and IRP1-KO-shNFKB2 cells. (L and M) qRT-PCR detected the expression of LCN2 and FPN1 in IRP1-KO-NC and IRP1-KO-shNFKB2 cells. (N) Ferrous iron levels detected after knockdown of NFKB2 in IRP1-KO cells. (O) MDA levels detected after knockdown of NFKB2 in IRP1-KO cells. (P) DCF levels detected after knockdown of NFKB2 in IRP1-KO cells.

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet: High expression of NFKB2 activates LCN2/FPN1 to mediate ferroptosis resistance in GBM cells (A) Western Blot analysis detected the expression of LCN2 and FPN1 in IRP1-NC and IRP1-KO cells. (B and C) qRT-PCR detected the expression of LCN2 and FPN1 in IRP1-NC and IRP1-KO cells. (D) Western Blot analysis to detect NFKB2 protein levels in parental cells transfected with lv-NFKB2. (E and F) qRT-PCR detected the expression of LCN2 and FPN1 in NC and lvNFKB2 cells. (G) ChIP assay of the enrichment of NFKB2 in the LCN2 and FPN1 promoter region normalized to IgG in U87 cells. (H) Ferrous iron levels detected after overexpression of NFKB2 in parental cells. (I) MDA levels detected after overexpression of NFKB2 in parental cells. (J) DCF levels detected after overexpression of NFKB2 in parental cells. (K) Western Blot analysis detected the expression of LCN2 and FPN1 in IRP1-KO-NC and IRP1-KO-shNFKB2 cells. (L and M) qRT-PCR detected the expression of LCN2 and FPN1 in IRP1-KO-NC and IRP1-KO-shNFKB2 cells. (N) Ferrous iron levels detected after knockdown of NFKB2 in IRP1-KO cells. (O) MDA levels detected after knockdown of NFKB2 in IRP1-KO cells. (P) DCF levels detected after knockdown of NFKB2 in IRP1-KO cells.

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques: Expressing, Western Blot, Quantitative RT-PCR, Transfection, Over Expression, Knockdown

Overexpressed IRP1 enhances ferroptosis-based TMZ antitumor therapy in vivo (A) Schematic illustration of the GBM orthotopic xenograft model. (B) Bioluminescence images of tumor growth after tumor implantation. n = 6 for each group. (C) Tumor growth curves by quantification of bioluminescent imaging signal intensities. Data were represented as the mean ± SD (n = 6). (D) Mice body weight curves started with the generation of xenograft model. Data were represented as the mean ± SD (n = 6). (E) Kaplan-Meier survival curve of nude mice. Data are represented as the mean ± SD (n = 6). (F) Representative images of H&E staining showing tumor volume in the nude mice. (G) IHC staining for Ki67 in brain tumor samples. Scale bar, 50 μm. (H) Relative level of Ferrous iron in brain tumor samples. (I) Relative level of MDA in brain tumor samples.

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet: Overexpressed IRP1 enhances ferroptosis-based TMZ antitumor therapy in vivo (A) Schematic illustration of the GBM orthotopic xenograft model. (B) Bioluminescence images of tumor growth after tumor implantation. n = 6 for each group. (C) Tumor growth curves by quantification of bioluminescent imaging signal intensities. Data were represented as the mean ± SD (n = 6). (D) Mice body weight curves started with the generation of xenograft model. Data were represented as the mean ± SD (n = 6). (E) Kaplan-Meier survival curve of nude mice. Data are represented as the mean ± SD (n = 6). (F) Representative images of H&E staining showing tumor volume in the nude mice. (G) IHC staining for Ki67 in brain tumor samples. Scale bar, 50 μm. (H) Relative level of Ferrous iron in brain tumor samples. (I) Relative level of MDA in brain tumor samples.

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques: In Vivo, Tumor Implantation, Imaging, Staining, Immunohistochemistry

The schematic model describes how ferroptosis which IRP1 mediated affects the progression of TMZ resistance in GBM cells via regulating the noncanonical NF-κB pathway

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet: The schematic model describes how ferroptosis which IRP1 mediated affects the progression of TMZ resistance in GBM cells via regulating the noncanonical NF-κB pathway

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques:

Journal: iScience

Article Title: IRP1 mediated ferroptosis reverses temozolomide resistance in glioblastoma via affecting LCN2/FPN1 signaling axis depended on NFKB2

doi: 10.1016/j.isci.2023.107377

Figure Lengend Snippet:

Article Snippet: CRISPR sgRNA targeting sequence: IRP1 #2: AGA AGA ACT CTG ATC GAA AA , GeneChem , N/A.

Techniques: Virus, Recombinant, Membrane, CCK-8 Assay, Lysis, BIA-KA, Multiple Displacement Amplification, GSSG Assay, Iron Assay, Fluorescence, CRISPR, Sequencing, shRNA, Software

a , Schematic of genome-scale CRISPRa screening approach (see text for details). b , Overview of CRISPRa screen results. Negative τ values indicate depletion and positive values enrichment of cells following imatinib selection. Significant candidate genes (FDR<0.05, p<0.001) are in colour (blue = depleted, red = enriched). Validated candidate genes are labelled in black. Mann-Whitney U test was used to calculate p-values as described previously . To correct for multiple hypothesis testing, we first performed random sampling with replacement among the set of τ values for non-targeting control sgRNAs and calculated p-values for each sampling. Then, we calculated the false discover rate (FDR) based on the distribution of p-values for all genes in the library and for non-targeting controls generated above. c, Candidate gene validation. Enrichment of candidate sgRNA expressing cells was measured over time. Values represent the mean of three different sgRNAs targeting each gene with s.e.m. Grey shading = two standard deviations of sgNTCs at day 15. All values from separate sgRNAs on days 7, 11 and 15 normalised to baseline or untreated cells are shown in .

Journal: Nature biotechnology

Article Title: Dual gene activation and knockout screen reveals directional dependencies in genetic networks

doi: 10.1038/nbt.4062

Figure Lengend Snippet: a , Schematic of genome-scale CRISPRa screening approach (see text for details). b , Overview of CRISPRa screen results. Negative τ values indicate depletion and positive values enrichment of cells following imatinib selection. Significant candidate genes (FDR<0.05, p<0.001) are in colour (blue = depleted, red = enriched). Validated candidate genes are labelled in black. Mann-Whitney U test was used to calculate p-values as described previously . To correct for multiple hypothesis testing, we first performed random sampling with replacement among the set of τ values for non-targeting control sgRNAs and calculated p-values for each sampling. Then, we calculated the false discover rate (FDR) based on the distribution of p-values for all genes in the library and for non-targeting controls generated above. c, Candidate gene validation. Enrichment of candidate sgRNA expressing cells was measured over time. Values represent the mean of three different sgRNAs targeting each gene with s.e.m. Grey shading = two standard deviations of sgNTCs at day 15. All values from separate sgRNAs on days 7, 11 and 15 normalised to baseline or untreated cells are shown in .

Article Snippet: For the CRISPRa library, the designed 20 nt target specific sgRNA sequences were synthesised as a pool, on microarray surfaces (CustomArray, Inc.), flanked by overhangs compatible with Gibson Assembly into the pSico based sgLenti sgRNA library vector (see for vector map).

Techniques: Selection, MANN-WHITNEY, Sampling, Generated, Expressing

a, Concept of the application of the orthogonal system for directional gene interaction studies. In the same cell, one gene is activated (CRISPRa) while another gene in knocked out (SaCas9 nuclease). b–d, Correlation of τ values from two clonal cell line replicates is shown for b, gene activation, c, gene knockout and d, all possible combinations thereof. Correlation values (r) are Pearson product-moment correlation coefficients. e , Schematic of perturbation data set from each gene pair (blue = depleted, red = enriched, NTC = non-target control sgRNA) f, Formula for calculating Ψ scores. Negative Ψ scores define interactions in which directionality could be inferred. g , To determine which of both interaction partners acts up- or downstream, τ activation values were multiplied with genetic interaction scores. Positive values indicate a downstream function, negative values an upstream function of the activated gene. h , Based on GI and Ψ scores determined by the full orthogonal interaction screen, a genetic interaction model was constructed. For positive regulators of cell fitness, nodes are shown in red and negative regulators in blue. Arrow-shaped edges indicate inferred directional interactions between nodes. Line-shaped edges symbolise genetic interactions where directionality could not be inferred. Node sizes are proportional to the degree of connectivity. In total, 2258 gene:gene combinations that passed the filter criteria were considered for the construction of the directional genetic interaction network.

Journal: Nature biotechnology

Article Title: Dual gene activation and knockout screen reveals directional dependencies in genetic networks

doi: 10.1038/nbt.4062

Figure Lengend Snippet: a, Concept of the application of the orthogonal system for directional gene interaction studies. In the same cell, one gene is activated (CRISPRa) while another gene in knocked out (SaCas9 nuclease). b–d, Correlation of τ values from two clonal cell line replicates is shown for b, gene activation, c, gene knockout and d, all possible combinations thereof. Correlation values (r) are Pearson product-moment correlation coefficients. e , Schematic of perturbation data set from each gene pair (blue = depleted, red = enriched, NTC = non-target control sgRNA) f, Formula for calculating Ψ scores. Negative Ψ scores define interactions in which directionality could be inferred. g , To determine which of both interaction partners acts up- or downstream, τ activation values were multiplied with genetic interaction scores. Positive values indicate a downstream function, negative values an upstream function of the activated gene. h , Based on GI and Ψ scores determined by the full orthogonal interaction screen, a genetic interaction model was constructed. For positive regulators of cell fitness, nodes are shown in red and negative regulators in blue. Arrow-shaped edges indicate inferred directional interactions between nodes. Line-shaped edges symbolise genetic interactions where directionality could not be inferred. Node sizes are proportional to the degree of connectivity. In total, 2258 gene:gene combinations that passed the filter criteria were considered for the construction of the directional genetic interaction network.

Article Snippet: For the CRISPRa library, the designed 20 nt target specific sgRNA sequences were synthesised as a pool, on microarray surfaces (CustomArray, Inc.), flanked by overhangs compatible with Gibson Assembly into the pSico based sgLenti sgRNA library vector (see for vector map).

Techniques: Activation Assay, Gene Knockout, Construct

a Transfection efficiency of HN6 and CAL27 NOTCH1 C1133Y and WT cells determined by real-time qPCR. b Growth curves of NOTCH1 WT -transfected cells (blue lines), NOTCH1 C1133Y -transfected cells (red lines) and control cells (black lines). The NOTCH1 C1133Y -transfected cells had higher proliferation rates compared with the NOTCH1 WT -transfected cells. c Colony formation assays were performed for 2 week in six-well cell culture cluster in HN6 and CAL27 stable transfected cells. d NOTCH1 C1133Y - transfected cells presented a significantly lower percentage of G1 phase and higher ratio of S phase than NOTCH1 WT cells. e , f Wound healing and Transwell assays were employed to analyze the cell migration and invasion ability. NOTCH1 C1133Y -transfected cells exhibited higher metastatic ability in HN6 and CAL27 cell lines compared with NOTCH1 WT -transfected cells. g mRNA expression levels of three isoforms of FBXW7 (relative to GAPDH) after transfection of NOTCH1 C1133Y or NOTCH1 WT in HN6 and CAL27 cells. FBXW7β mRNA was greatly reduced in NOTCH1 C1133Y transfected cells compared to FBXW7α or FBXW7γ mRNA levels. h Left panel, the band of FBXW7 were detected by western blot after transfection of three individual isoform plasmids. Right panel, the alteration of FBXW7β protein levels in NOTCH1 C1133Y overexpressed cells. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a Transfection efficiency of HN6 and CAL27 NOTCH1 C1133Y and WT cells determined by real-time qPCR. b Growth curves of NOTCH1 WT -transfected cells (blue lines), NOTCH1 C1133Y -transfected cells (red lines) and control cells (black lines). The NOTCH1 C1133Y -transfected cells had higher proliferation rates compared with the NOTCH1 WT -transfected cells. c Colony formation assays were performed for 2 week in six-well cell culture cluster in HN6 and CAL27 stable transfected cells. d NOTCH1 C1133Y - transfected cells presented a significantly lower percentage of G1 phase and higher ratio of S phase than NOTCH1 WT cells. e , f Wound healing and Transwell assays were employed to analyze the cell migration and invasion ability. NOTCH1 C1133Y -transfected cells exhibited higher metastatic ability in HN6 and CAL27 cell lines compared with NOTCH1 WT -transfected cells. g mRNA expression levels of three isoforms of FBXW7 (relative to GAPDH) after transfection of NOTCH1 C1133Y or NOTCH1 WT in HN6 and CAL27 cells. FBXW7β mRNA was greatly reduced in NOTCH1 C1133Y transfected cells compared to FBXW7α or FBXW7γ mRNA levels. h Left panel, the band of FBXW7 were detected by western blot after transfection of three individual isoform plasmids. Right panel, the alteration of FBXW7β protein levels in NOTCH1 C1133Y overexpressed cells. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Transfection, Cell Culture, Migration, Expressing, Western Blot

a The subcellular location of NOTCH1 receptors in CAL27 cells was assessed by immunofluorescence. The NOTCH1-FITC staining revealed that NOTCH1 protein in C1133Y-mutated cells was only localized in the cytoplasm. Costaining of NOTCH1 with ER-marker Calnexin showed strong overlapped staining in NOTCH1 C1133Y -transfected cells. FBXW7β-EGFP staining was present in the microsomal fraction together with the ER-resident protein Calnexin. Scale bar, 20 μm. b The localization of NOTCH1 or FBXW7β in cytoplasm or nucleus was assessed in 100 cells, and the percent of cells was shown. The data indicated that 79.3% of NOTCH1 C1133Y -transfected cells and 85.3% of FBXW7β-transfected cells exhibited cytoplasmic expression, but that only 54% of NOTCH1 WT -transfected cells exhibited cell cytoplasmic expression. c Overlapped staining of NOTCH1 or FBXW7β with ER-marker Calnexin was counted in NOTCH1 C1133Y and NOTCH1 WT or FBXW7β transfected cells. In all, 82.8% of NOTCH1 C1133Y -transfected cells and 91.2% of FBXW7β-transfected cells showed overlap between FITC (NOTCH1 or FBXW7β staining) and CY3 (Calnexin staining), while 50.5% of NOTCH1 WT -transfected cells showed overlapped staining between NOTCH1 and Calnexin. Data are mean ± SD. Percentages of localization were calculated from three independent experiments. ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a The subcellular location of NOTCH1 receptors in CAL27 cells was assessed by immunofluorescence. The NOTCH1-FITC staining revealed that NOTCH1 protein in C1133Y-mutated cells was only localized in the cytoplasm. Costaining of NOTCH1 with ER-marker Calnexin showed strong overlapped staining in NOTCH1 C1133Y -transfected cells. FBXW7β-EGFP staining was present in the microsomal fraction together with the ER-resident protein Calnexin. Scale bar, 20 μm. b The localization of NOTCH1 or FBXW7β in cytoplasm or nucleus was assessed in 100 cells, and the percent of cells was shown. The data indicated that 79.3% of NOTCH1 C1133Y -transfected cells and 85.3% of FBXW7β-transfected cells exhibited cytoplasmic expression, but that only 54% of NOTCH1 WT -transfected cells exhibited cell cytoplasmic expression. c Overlapped staining of NOTCH1 or FBXW7β with ER-marker Calnexin was counted in NOTCH1 C1133Y and NOTCH1 WT or FBXW7β transfected cells. In all, 82.8% of NOTCH1 C1133Y -transfected cells and 91.2% of FBXW7β-transfected cells showed overlap between FITC (NOTCH1 or FBXW7β staining) and CY3 (Calnexin staining), while 50.5% of NOTCH1 WT -transfected cells showed overlapped staining between NOTCH1 and Calnexin. Data are mean ± SD. Percentages of localization were calculated from three independent experiments. ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Immunofluorescence, Staining, Marker, Transfection, Expressing

a Fold change of FBXW7β mRNA levels in 30 paired OSCC tissues. b Fold change of FBXW7β protein expression levels in eight OSCC tissues and two nontumor tissues. c Relative FBXW7β mRNA and protein levels in five OSCC cell lines and one normal oral epithelial cell line (HOK). d qRT-PCR detection after transfection of PEGFP-N1-FBXW7α or PEGFP-N1-FBXW7β or PEGFP-N1-FBXW7γ and empty vector in HN6 and CAL27 cells. e – g Wound healing ( e ), Transwell ( f ), and CCK-8 ( g ) assays were employed to analyze the cell migration, invasion, and proliferation ability. Compared with other two subtypes, overexpression of FBXW7β significantly reduced cell growth, migration, and invasion. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a Fold change of FBXW7β mRNA levels in 30 paired OSCC tissues. b Fold change of FBXW7β protein expression levels in eight OSCC tissues and two nontumor tissues. c Relative FBXW7β mRNA and protein levels in five OSCC cell lines and one normal oral epithelial cell line (HOK). d qRT-PCR detection after transfection of PEGFP-N1-FBXW7α or PEGFP-N1-FBXW7β or PEGFP-N1-FBXW7γ and empty vector in HN6 and CAL27 cells. e – g Wound healing ( e ), Transwell ( f ), and CCK-8 ( g ) assays were employed to analyze the cell migration, invasion, and proliferation ability. Compared with other two subtypes, overexpression of FBXW7β significantly reduced cell growth, migration, and invasion. Data are mean ± SD from three independent experiments. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Expressing, Quantitative RT-PCR, Transfection, Plasmid Preparation, CCK-8 Assay, Migration, Over Expression

a Flow cytometry analysis showed cell cycle arrest due to FBXW7β transfection (left panel). Proteins related to cell cycle progression were demonstrated (middle and right panel). FBXW7β overexpression resulted in the decreased expression levels of cell cycle related proteins. b FBXW7β-sgRNA dramatically increased the number of colonies (left panel) and cell growth (right panel). c , d Depleting FBXW7β potently promoted cell migration ( c ) and invasion ( d ). Data are mean ± SD from three independent experiments. e The tumors dissected from mice ( n = 6 for each group) were presented. f – h Evaluation on tumor incidence ( f ), weight ( g ), and size ( h ). All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a Flow cytometry analysis showed cell cycle arrest due to FBXW7β transfection (left panel). Proteins related to cell cycle progression were demonstrated (middle and right panel). FBXW7β overexpression resulted in the decreased expression levels of cell cycle related proteins. b FBXW7β-sgRNA dramatically increased the number of colonies (left panel) and cell growth (right panel). c , d Depleting FBXW7β potently promoted cell migration ( c ) and invasion ( d ). Data are mean ± SD from three independent experiments. e The tumors dissected from mice ( n = 6 for each group) were presented. f – h Evaluation on tumor incidence ( f ), weight ( g ), and size ( h ). All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Flow Cytometry, Transfection, Over Expression, Expressing, Migration

a , b Western blotting was used to detect the expression levels of NOTCH1 and FBXW7β. The overexpression of NOTCH1 C1133Y decreased FBXW7β expression, whereas the upregulation of FBXW7β attenuated the loss of FBXW7β expression in NOTCH1 C1133Y overexpressed HN6 and CAL27 cells. c CCK-8 assay showed that upregulation of NOTCH1 C1133Y dramatically increased the cell proliferation ability in HN6 and CAL27 cells. d Transwell assay showed that the upregulation of FBXW7β significantly reduced the cell invasion in NOTCH1 C1133Y transfected cells. Data are mean ± SD from three independent experiments. e The tumors dissected from mice were presented ( n = 6 for each group). From top to bottom, each line of tumors represented: FBXW7β, NOTCH1 C1133Y , FBXW7β+ NOTCH1 C1133Y , and NC. f – h Evaluation on tumor incidence, weight, and size. All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a , b Western blotting was used to detect the expression levels of NOTCH1 and FBXW7β. The overexpression of NOTCH1 C1133Y decreased FBXW7β expression, whereas the upregulation of FBXW7β attenuated the loss of FBXW7β expression in NOTCH1 C1133Y overexpressed HN6 and CAL27 cells. c CCK-8 assay showed that upregulation of NOTCH1 C1133Y dramatically increased the cell proliferation ability in HN6 and CAL27 cells. d Transwell assay showed that the upregulation of FBXW7β significantly reduced the cell invasion in NOTCH1 C1133Y transfected cells. Data are mean ± SD from three independent experiments. e The tumors dissected from mice were presented ( n = 6 for each group). From top to bottom, each line of tumors represented: FBXW7β, NOTCH1 C1133Y , FBXW7β+ NOTCH1 C1133Y , and NC. f – h Evaluation on tumor incidence, weight, and size. All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Western Blot, Expressing, Over Expression, CCK-8 Assay, Transwell Assay, Transfection

a , b AKT/ERK/NFκB signaling activities were evaluated by western blot analysis in HN6 ( a ) and CAL27 cells ( b ). The gray values of images demonstrated that FBXW7β transfection decreased phosphorylation of AKT/ERK/NFκB and reversed the NOTCH1 C1133Y -induced activation of AKT/ERK/NFκB phosphorylation. c , d Overexpression of FBXW7β reversed the increased protein expression levels of EMT markers and prevented the decrease in E-cadherin and β-Catenin caused by NOTCH1 C1133Y in HN6 ( c ) and CAL27 ( d ) cells. e The expression of p-AKT, p-ERK, and p-NFκB in xenografted mice was ascertained using IHC assay on tumor sections. The percentages of positive cells were acquired from three separate images and the qualification was presented. Scale bar, 20 μm. All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a , b AKT/ERK/NFκB signaling activities were evaluated by western blot analysis in HN6 ( a ) and CAL27 cells ( b ). The gray values of images demonstrated that FBXW7β transfection decreased phosphorylation of AKT/ERK/NFκB and reversed the NOTCH1 C1133Y -induced activation of AKT/ERK/NFκB phosphorylation. c , d Overexpression of FBXW7β reversed the increased protein expression levels of EMT markers and prevented the decrease in E-cadherin and β-Catenin caused by NOTCH1 C1133Y in HN6 ( c ) and CAL27 ( d ) cells. e The expression of p-AKT, p-ERK, and p-NFκB in xenografted mice was ascertained using IHC assay on tumor sections. The percentages of positive cells were acquired from three separate images and the qualification was presented. Scale bar, 20 μm. All the results were shown as mean ± SD. * p < 0.05, ** p < 0.01, *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Western Blot, Transfection, Activation Assay, Over Expression, Expressing

a HN6 and CAL27 NOTCH1 C1133Y -transfected cells were treated with MG132 (10 μM) for the indicated times, and then the levels of NOTCH1 were detected. b The cells were subjected to cycloheximide (CHX) (20 μM) exposure at the indicated times, and the protein expression levels of NOTCH1 were verified. c Co-IP between NOTCH1 C1133Y and ubiquitin in HN6 and CAL27 cells. d Co-IP experiment showed that NOTCH1 C1133Y could be co-precipitated together with FBXW7β. HN6 or CAL27 cells were transfected with NOTCH1 C1133Y , NOTCH1 WT , or NC plasmids and precipitated with NOTCH1 antibody. IgG group presented the lysates of cells transfected with NOTCH1 C1133Y were precipitated with igG, which represented the negative control. e Detection of the effects of NOTCH1 C1133Y on FBXW7β expression, either with or without CHX (20 μM) in HN6 and CAL27 cells. f Ectopic dose-dependent effect of NOTCH1 C1133Y overexpression caused a significant reduction of endogenous FBXW7β proteins. g Co-IP experiment showed MG-132 promoted the binding level of NOTCH1 and FBXW7β. The cells in NOTCH1 C1133Y groups were treated with or without proteasomal inhibitor MG132 (10 μM). Cell lysates were prepared and subjected to immunoprecipitation with anti-GFP antibody. The level of FBXW7β was detected by western blotting analysis. Data are mean ± SD from three independent experiments. *** p < 0.001.

Journal: Cell Death & Disease

Article Title: Isoform specific FBXW7 mediates NOTCH1 Abruptex mutation C1133Y deregulation in oral squamous cell carcinoma

doi: 10.1038/s41419-020-02873-4

Figure Lengend Snippet: a HN6 and CAL27 NOTCH1 C1133Y -transfected cells were treated with MG132 (10 μM) for the indicated times, and then the levels of NOTCH1 were detected. b The cells were subjected to cycloheximide (CHX) (20 μM) exposure at the indicated times, and the protein expression levels of NOTCH1 were verified. c Co-IP between NOTCH1 C1133Y and ubiquitin in HN6 and CAL27 cells. d Co-IP experiment showed that NOTCH1 C1133Y could be co-precipitated together with FBXW7β. HN6 or CAL27 cells were transfected with NOTCH1 C1133Y , NOTCH1 WT , or NC plasmids and precipitated with NOTCH1 antibody. IgG group presented the lysates of cells transfected with NOTCH1 C1133Y were precipitated with igG, which represented the negative control. e Detection of the effects of NOTCH1 C1133Y on FBXW7β expression, either with or without CHX (20 μM) in HN6 and CAL27 cells. f Ectopic dose-dependent effect of NOTCH1 C1133Y overexpression caused a significant reduction of endogenous FBXW7β proteins. g Co-IP experiment showed MG-132 promoted the binding level of NOTCH1 and FBXW7β. The cells in NOTCH1 C1133Y groups were treated with or without proteasomal inhibitor MG132 (10 μM). Cell lysates were prepared and subjected to immunoprecipitation with anti-GFP antibody. The level of FBXW7β was detected by western blotting analysis. Data are mean ± SD from three independent experiments. *** p < 0.001.

Article Snippet: The sgRNA sequences of FBXW7β were made by Shanghai Genepharma (Shanghai, China).

Techniques: Transfection, Expressing, Co-Immunoprecipitation Assay, Negative Control, Over Expression, Binding Assay, Immunoprecipitation, Western Blot